Chilobrachys qishuoi Lin & Li, 2022

Lin, Ye-Jie, Li, Shuqiang & Xie, Chunyan, 2022, A new species of Chilobrachys (Araneae, Theraphosidae) from Guangdong, China, Biodiversity Data Journal 10, pp. 96467-96467 : 96467

publication ID

https://dx.doi.org/10.3897/BDJ.10.e96467

publication LSID

lsid:zoobank.org:pub:D5B125EE-8224-4086-AAB8-225928490B79

persistent identifier

https://treatment.plazi.org/id/7E59432F-1BD3-5103-90A0-9BE9D4C6B696

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Chilobrachys qishuoi Lin & Li, 2022
status

sp. n.

Chilobrachys qishuoi Lin & Li, 2022 sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Shuo Qi and Jincheng Liu ; sex: male; occurrenceID: E239F997-4C70-59CD-9731-D57BF718D5CC; Location : country: China; stateProvince: Guangdong; municipality: Qingyuan City ; locality: Qingxin District , X 366 Road , near Jingdong ; verbatimElevation: 313 m; verbatimCoordinates: N24.2320°, E112.8048°; Identification: identifiedBy: Yejie Lin; Event: year: 2022; month: 9; day: 17-22; Record Level: institutionID: IZCAS-Ar 43549 Type status: Paratype. Occurrence: recordedBy: Shuo Qi and Jincheng Liu ; sex: male; occurrenceID: B011EB7C-D71C-58FF-9649-488522763C14; Location : country: China; stateProvince: Guangdong; municipality: Qingyuan City ; locality: Qingxin District , X 366 Road , near Jingdong ; verbatimElevation: 313 m; verbatimCoordinates: N24.2320°, E112.8048°; Identification: identifiedBy: Yejie Lin; Event: year: 2022; month: 9; day: 17-22; Record Level: institutionID: IZCAS-Ar 43550 Type status: Paratype. Occurrence: recordedBy: Shuo Qi and Jincheng Liu ; sex: male; occurrenceID: B011EB7C-D71C-58FF-9649-488522763C14; Location : country: China; stateProvince: Guangdong; municipality: Qingyuan City ; locality: Qingxin District , X 366 Road , near Jingdong ; verbatimElevation: 313 m; verbatimCoordinates: N24.2320°, E112.8048°; Identification: identifiedBy: Yejie Lin; Event: year: 2022; month: 9; day: 17-22; Record Level: institutionID: IZCAS-Ar 43551 Type status: Paratype. Occurrence: recordedBy: Shuo Qi; sex: female; occurrenceID: B011EB7C-D71C-58FF-9649-488522763C14; Location : country: China; stateProvince: Guangdong; municipality: Qingyuan City ; locality: Qingxin District , X 366 Road , near Jingdong ; verbatimElevation: 313 m; verbatimCoordinates: N24.2320°, E112.8048°; Identification: identifiedBy: Yejie Lin; Event: year: 2022; month: 8; day: 20; Record Level: institutionID: IZCAS-Ar 43552 Type status: Paratype. Occurrence: recordedBy: Shuo Qi and Jincheng Liu ; sex: female; occurrenceID: B011EB7C-D71C-58FF-9649-488522763C14; Location : country: China; stateProvince: Guangdong; municipality: Qingyuan City ; locality: Qingxin District , X 366 Road , near Jingdong ; verbatimElevation: 313 m; verbatimCoordinates: N24.2320°, E112.8048°; Identification: identifiedBy: Yejie Lin; Event: year: 2022; month: 9; day: 17-22; Record Level: institutionID: IZCAS-Ar43553 GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps

Description

Male (holotype, IZCAS-Ar43549) (Fig. 2 View Figure 2 A, Fig. 3 View Figure 3 , Fig. 5 View Figure 5 , Fig. 6 View Figure 6 A, B and Fig. 7 View Figure 7 A).

Colouration in alcohol: Carapace, palp and legs red brown. Chelicerae and abdomen black (Fig. 3 View Figure 3 A).

Carapace 11.27 long, 9.82 wide, with long white setae. Eye group 2.02 long, 0.91 wide. MOA 1.24 long, anterior width 0.96, posterior width 1.24 (Fig. 3 View Figure 3 B). Eye sizes and interdistances: ALE 0.47, AME 0.42, PLE 0.38, PME 0.38; ALE-AME 0.11, AME-AME 0.18, PLE-PME 0.09, PME-PME 0.79. Fovea deep, slightly procurved, on one third of the carapace, occupying about one fifth of carapace width at that point. Four pairs of radial furrows (Fig. 3 View Figure 3 A).

Chelicera 6.94 long, 4.80 high, with long white grey setae. Promargin with dense brown hairs, retromargin with one row of 11 teeth, fang furrow with 35 denticles, strikers spiniform. Fang 5.54 long (Fig. 3 View Figure 3 G and H).

Labium 1.68 long, 2.21 wide, with 457 cuspules, covering almost 1/3 of area of labium, terminal brown, with long bristles (Fig. 3 View Figure 3 D).

Maxilla 4.73 long, 2.18 wide, with 267 cuspules. Stridulating lyra almost two times longer than height, with two kinds of stridulating setae: one row of 10 club-shaped, straight setae and dense spiniform setae (Fig. 3 View Figure 3 C, E and F).

Sternum 5.20 long, 4.47 wide, yellow brown, covered with two kinds of hairs: black erect bristles and non-erect brown hairs, separated from labium by fan-shaped areas. Three pairs of sigilla present, anterior pair small, oval; posterior pairs larger (Fig. 3 View Figure 3 D).

Legs with dense long and white setae on patellae and tibiae, without any spines. Tarsi I-III with 2 claws, tarsus IV with 3 claws, without denticle. Leg measurements: I 43.11 (12.46 + 4.92+ 11.17 + 8.57 + 5.99), II 37.47 (10.34 + 3.47 + 9.99 + 7.74 + 5.93), III 31.93 (8.07 + 3.28 + 8.09 + 8.12 + 4.37), IV 44.09 (11.57 + 3.45 + 11.55 + 11.92 + 5.60). Leg formula: 4123. Scopula on tarsus IV cracked by a band of macrosetae, scopulae of tarsi I-III not divided.

Abdomen 12.11 long, 6.37 wide, oval, without any pattern, covered with long light brown and white setae of varying lengths. PMS 1.75 long, PLS 8.99 long.

Palp (Fig. 5 View Figure 5 , Fig. 6 View Figure 6 A, B and Fig. 7 View Figure 7 A). Tibia with many setae laterally, swollen at base. Bulb oval, with tegular apophysis; embolus slightly curved, slender, sickle-shaped, with weakly developed apical, prolateral inferior and prolateral superior keels. Distal edge of embolus flat.

Female (one paratype, IZCAS-Ar43552) (Fig. 2 View Figure 2 B, Fig. 4 View Figure 4 and Fig. 9 d).

Colouration in alcohol: Same as in male (Fig. 4 View Figure 4 A).

Carapace 18.75 long, 16.54 wide, with long light brown setae. Eye group 6.41 long, 2.72 wide. MOA 2.19 long, anterior width 2.87, posterior width 4.45 (Fig. 4 View Figure 4 B). Eye sizes and interdistances: ALE 1.29, AME 0.98, PLE 1.24, PME 1.05; ALE-AME 0.66, AME-AME 0.71, PLE-PME 0.37, PME-PME 2.90. Others as in male (Fig. 4 View Figure 4 A).

Chelicera 10.68 long, 7.93 high, with long light brown setae. Promargin with dense brown hairs, retromargin with one row of 18 teeth, fang furrow with 94 denticles, strikers spiniform. Fang 8.68 long (Fig. 4 View Figure 4 G and H).

Labium 2.60 long, 2.98 wide, with 580 cuspules, others as in male (Fig. 4 View Figure 4 D).

Maxilla 8.02 long, 4.29 wide, with 580 cuspules. Stridulating lyra almost three times longer than its height, others as in male (Fig. 4 View Figure 4 C, E and F).

Sternum 8.48 long, 5.13 wide, others as in male (Fig. 4 View Figure 4 D).

Legs with long and short brown setae, others as in male. Leg measurements: I 52.92 (15.19 + 6.58+ 13.56 + 9.37 + 8.22), II 45.25 (13.09 + 5.90 + 11.21 + 8.67 + 6.38), III 40.12 (10.16 + 5.30 + 9.04 + 9.04 + 6.58), IV 51.89 (13.47 + 5.46 + 12.72 + 13.18 + 7.06). Leg formula: 1423.

Abdomen 20.36 long, 12.38 wide, covered with long light brown setae of varying lengths. PMS 2.75 long, PLS 11.87 long.

Spermathecae (Fig. 9 d) simple. Two separated spermathecal lobes, without branch, middle with contraction, swollen distally, straight with genital furrow. Receptacles: 1.62 long, neck width 0.32, base width 0.71; contraction area: 0.46 long; spermathecal lobe: 0.50 long, 0.44 wide. LSE: 1.13 wide, BSE: 0.77 wide. BRV: 56%, LRV: 27%, LBW: 48%, NBW: 35%, NLW: 72%, LSE-BSE 68%.

Diagnosis

The new species is similar in habitus to C. hubei : the male with dense white setae on carapace, patellae and tibiae and the female with light brown carapace and chelicerae (Fig. 2 View Figure 2 A and B, Yu et al. 2021, figs. 3A and B). The bulbis similar to those of C. hubei and C. liboensis in having the same angle of the embolus relative to the bulb. The spermathecae are similar to those of C. hubei and C. lubricus by the spermathecal lobes swollen, with contraction at the neck, the base of the receptacles wider than the spermathecal lobes. The ratio of the length of the receptacle to BSE is almost 1:0.5 in C. qishuoi sp. n. and C. hubei and the length ratio of the spermathecal lobe to the contraction area is almost 1:1 in C. qishuoi sp. n. and C. lubricus (Fig. 9 c, d, Yu et al. 2021, figs. 2C-E).

However, the male of C. qishuoi sp. n. can be distinguished from that of C. hubei by the apical keel with an angle range of 60° to 90° (Fig. 7 View Figure 7 ) [vs. 120° in C. hubei ( Fig. 8 c) and 150° in C. liboensis (Fig. 8 e)], the terminal of the embolus at a right angle in C. qishuoi sp. n. (Fig. 7 View Figure 7 ) [vs. blunt in C. hubei and C. liboensis (Fig. 8 c, e)] and the length ratio of the prolateral inferior keel to the apical keel almost 75%-80% in C. qishuoi sp. n. (Fig. 7 View Figure 7 ) [vs. 62% in C. hubei ( Fig. 8 c) and 42% in C. liboensis (Fig. 8 e)]. In females, the length ratio of the spermathecal lobes to the neck is almost 1:1 in C. qishuoi sp. n. (Fig. 9 d) [vs. 1:0.25 in C. hubei (Fig. 9 b, Yu et al. 2021, fig. 2F)], the receptacles are at 90° angle with genital furrow, with LBW almost 50% and the ratio of the length of the receptacle to the BSE almost 1:0.5 (Fig. 9 d) [vs. 75° angle, LBW more than 50% and the ratio almost 1:0.3 in C. lubricus (Fig. 9 c, Yu et al. 2021, figs. 2D and E)].

Etymology

The species is named after Mr. Shuo Qi, who collected type material; noun (name) in genitive case.

Distribution

Known only from the type locality (China, Guangdong) (Fig. 10 View Figure 10 ).

Ecology

The specimens were found in barren limestone rock walls with some vegetation (Fig. 1 View Figure 1 B). They construct their retreats in natural rock burrows formed in the karst landscape; the burrows are usually about 6 to 8 cm in diameter. The web extends 20 to 30 cm inwards from the burrow (Fig. 1 View Figure 1 A). At night, they move to the entrance of the burrow, waiting for prey to pass by (Fig. 1 View Figure 1 C).

DNA barcode

CTATTATTAGATCATCTGTTGGGAAGCGTGAGCCCTTCGGAACTTTGGGAATAATTTATGCTATGGTTAGAATTGGTGGGATGGGGTTTGTTGTATGAGCTCATCATATGTTTTCTGTGGGAATAGATGTAGATACGCGGGCATATTTTACGGCAGCAACTATGGTGATTGCTGTCCCTACGGGAATTAGGGTATTTAGATGAATAGCTACGTTGTATGGATCTTACTTTAAGATGGATACCTCTTTGATATGGTGTGTTGGGTTCGTTTTTTTGTTTACTTTAGGGGGATTAACCGGGGTGGTTTTGGCTAATTCTTCTTTGGATATTATTTTGCATGATACTTATTATGTGGTTGCTCATTTTC (Ar43552, GenBank accession number OP394115).

Kingdom

Animalia

Phylum

Arthropoda

Class

Arachnida

Order

Araneae

Family

Theraphosidae

Genus

Chilobrachys