Phaenoglyphis salicis (Cameron, 1883)
publication ID |
https://doi.org/10.3897/BDJ.12.e120950 |
DOI |
https://doi.org/10.5281/zenodo.13820770 |
persistent identifier |
https://treatment.plazi.org/id/BEAC6B79-6294-5609-B443-84044EDD25AB |
treatment provided by |
|
scientific name |
Phaenoglyphis salicis (Cameron, 1883) |
status |
|
Phaenoglyphis salicis (Cameron, 1883)
Materials
Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; occurrenceID: CAE83B1F-A869-546B-986C-B850D5B50415; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: salicis ; scientificNameAuthorship: (Cameron, 1883); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Rhein-Sieg-Kreis; locality: Alfter, playground next to " KiTa Rasselbande " ; verbatimElevation: 86 m; decimalLatitude: 50.7343; decimalLongitude: 7.0138; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1514; samplingProtocol: hand picked; eventDate: 2022-5 - 5; year: 1883; habitat: among wood chips on ground; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2634968; basisOfRecord: PreservedSpecimen
Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 87B29A24-80BF-5955-AF20-8ED77C8898E3; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: salicis ; scientificNameAuthorship: (Cameron, 1883); Location: country: Germany; countryCode: DE; stateProvince: Rhineland-Palatinate; municipality: Cochem; locality: Nat. res. Brauselay ; verbatimElevation: 94 m; decimalLatitude: 50.1416; decimalLongitude: 7.1875; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 919; samplingProtocol: Malaise trap; eventDate: 2020-5 - 29; year: 1883; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641264; basisOfRecord: PreservedSpecimen
Diagnosis
Antennae of both sexes with rhinaria beginning on F 3, pedicel shorter than F 1, F 1 longer than F 2, F 2 shorter than F 3, F 3 subequal to F 4 (Fig. 3 View Figure 3 d); pronotal carinae present, notauli weak, scutellar foveae oval, completely defined and with two lines anteriorly (Fig. 4 View Figure 4 d), propodeal carinae present; radial cell closed, 2.5 times as long as wide.
Molecular characterisation
Maximum barcode-distance within species: 0.2 % (2).
(Minimum) barcode-distance to closest species: 4.9 % ( P. longicornis ).
Consensus barcode sequence (652 bp):
5 ’ - TTTATTGTATTTTATTTTTGGAATTTGATCAGGAATAATTGGATCAGCTTTAAGAATAATTATTCGAATAGAATTAGGCACCCCATCTTCATTAATTGGTAATGACCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGAGGATTCGGTAATTATTTAGTTCCTTTAATATTAAGGGCTCCTGATATAGCTTTCCCACGATTAAACAATATAAGTTTTTGATTATTACCCCCCGCTTTATTTTTATTAACTTCTAGAATATTTATTGATCAAGGAGCTGGAACTGGATGAACTGTTTAYCCACCTCTCTCCTCTAATTTAGGCCATTCAGGGATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATCTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGGATCACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGAGGAGACCCTATTTTATACCAACATTTATTT- 3 ’
Distribution
Austria, Germany, Ireland, Italy, Romania, Spain, USA: Colorado, and United Kingdom: England, Scotland, Wales ( Ferrer-Suay et al. 2014, Ferrer-Suay et al. 2023).
Taxon discussion
See the taxon discussion of P. longicornis .
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |