Doggerella (Lelejobracon) chasanica ( Tobias, 2000 )

Kim, Moo-Sung, Kim, Il-Kwon, Sharkey, Michael & Kang, Ilgoo, 2025, New host record of Doggerella chasanica (Hymenoptera, Braconidae, Braconinae) as a larval parasitoid of the serious forest pest Monochamus alternatus (Coleoptera, Cerambycidae) in Korea, Journal of Hymenoptera Research 98, pp. 545-558 : 545-558

publication ID

https://doi.org/10.3897/jhr.98.151974

publication LSID

lsid:zoobank.org:pub:92001F25-50D3-4EBC-A546-71AD129A7FD7

DOI

https://doi.org/10.5281/zenodo.15424548

persistent identifier

https://treatment.plazi.org/id/F26F8B8D-1E08-506A-BFD6-8CDD4185F396

treatment provided by

Journal of Hymenoptera Research by Pensoft

scientific name

Doggerella (Lelejobracon) chasanica ( Tobias, 2000 )
status

 

Doggerella (Lelejobracon) chasanica ( Tobias, 2000)

Fig. 4 A ‒ F View Figure 4

Bracon chasanicus Tobias, 2000, Belokobylskij and Tobias 2000: 148. View in CoL

Doggerella (Lelejobracon) chasanica in Samartsev 2016: 124.

Bracon bitumor Papp, 2018: 26 .

Bracon planitibiae Yang, Cao & Gould, 2019, in Cao et al. 2019: 430.

Doggerella (Lelejobracon) chasanica ( Tobias, 2000), in Samartsev 2019: 54.

Doggerella (Lelejobracon) chasanica ( Tobias, 2000), in Samartsev et al. 2024: 198.

Material examined.

Non-type South Korea • 5 ♀; Hangyeong-myeon , Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 17.VI. ‒ 2.VII.2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: Monochamus alternatus GoogleMaps . • 2 ♀; Hangyeong-myeon , Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 1‒16.VII.2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: M. alternatus GoogleMaps .

Diagnosis.

Samartsev (2016) transferred Bracon chasanicus Tobias, 2000 to Doggerella Quicke, Mahmood & Papp, 2011 , establishing the subgenus Lelejobracon and recognizing D. (L.) chasanica as the only Doggerella (Lelejobracon) species recorded from Russia. Later, Samartsev (2019) synonymized Bracon planitibiae Yang, Cao & Gould, 2019 and B. bitumor Papp, 2018 with D. (L.) chasanica . Regarding the subgenus, as discussed in detail by Samartsev (2016), Lelejobracon is easily distinguished from Doggerella s. str., which is restricted to the Afrotropical region, by its smooth and polished metasoma (Fig. 4 C View Figure 4 ).

Molecular data.

The first COI DNA barcodes for Doggerella (Lelejobracon) chasanica were successfully obtained from specimens collected in Korea. The COI barcodes from two individuals were identical.

Consensus COI sequence (658 bp; GenBank accession numbers: PV 169210, PV 169211);

TATATTATATTTTTTTTTTGGTATTTGATCAGGAATTTTAGGTTTATCTATAAGAATAATTATTC GATTAGAATTAGGAATACCAGGAAGTTTATTAGGTAATGATCAAATTTATAATAGTATAGTAACTG CTCACGCATTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTAGGTGGGTTTGGAAATTGAT TAATTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAT TACTTATTCCTTCATTAATTTTATTAATTTTAAGAAGAATTTTAAATGTTGGTGTTGGAACTGGAT GAACAGTTTATCCTCCATTATCTTCTTCTTTAGGCCATAGAGGTATATCTGTTGATATAGCTATTT TTTCTTTACATTTAGCTGGAGCTTCATCAATTATAGGTTCAATTAATTTTATTACTACTATTTTTA ATATAAAATTAAATATTTTAAAATTAGATCAAATATCTTTGTTTATTTGATCAATTTTAATTACAA CAATTTTATTACTTTTATCTTTACCGGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAA ATTTTAATACATCATTTTTTGATTTTGCTGGTGGAGGAGATCCTGTTTTATTTCAACATTTATTT

Redescription.

The species was well-described by Samartsev (2016) and Samartsev et al. (2024). Most characters observed in the current study align with those described by Samartsev (2016) and Samartsev et al. (2024). However, we provide this redescription to include additional characters not mentioned in the previous studies and to provide a description with terminology that readers familiar with terminology used by Sharkey and Wharton (1997), particularly regarding wing vein terminology.

Body length 2.6 mm. Antenna length: 2.1 mm. Fore wing length 2.8 mm. Hind wing length 2.2 mm.

Head. Antenna with 24‒27 segments. 1 st flagellomere as long as 2 nd flagellomere (Fig. 4 A, E View Figure 4 ). Vertex smooth and polished, sparsely setaceous (Fig. 4 B View Figure 4 ). Frons entirely variolate. Face mostly variolate, width 1.5 × longer than its height (0.59: 0.39). Anterior ocellus 0.7 × longer than distance between posterior ocelli (0.04: 0.06). Eye sparsely setose; median width of eye 0.7 × longer than its height (0.24: 0.35) in lateral view and 1.7 × longer than median width of gena in lateral view (0.24: 0.14). Distance between anterior tentorial pits 0.15 mm. Hypoclypeal depression deep, 1.4 × longer than wide. Malar space 0.5 × longer than basal width of mandible (0.05: 0.11) and 1 / 6 of eye height in anterior view (0.05: 0.31).

Mesosoma. Mesosoma 1.5 × longer than maximum height in lateral view (1.08: 0.7) (Fig. 4 F View Figure 4 ). Mesoscutum entirely polished with long setae, basally punctate (Fig. 4 B View Figure 4 ). Notauli weakly present, not meeting posteriorly (Fig. 4 B View Figure 4 ). Scutellar sulcus straight, short, and finely crenulate. Scutellum entirely polished with long setae. Pronotum polished. Mesopleuron mostly smooth and polished; relatively bare medially (Fig. 4 F View Figure 4 ). Metapleuron entirely with long setae (Fig. 4 F View Figure 4 ). Propodeum entirely smooth and polished, anteriorly setose, 0.8 × longer than its maximum width (0.31: 0.39).

Legs. Fore femur 0.7 × longer than fore tibia (0.34: 0.48). Basal spur on fore tibia 0.5 × longer than fore basitarsus. Fore basitarsus 0.8 × longer than combined length of second to fourth tarsomeres (0.17: 0.22). Mid tibia as long as mid femur (0.41: 0.41). Basal spur on mid tibia 0.4 × longer than mid basitarsus (0.09: 0.23). Mid basitarsus as long as combined length of second to fourth tarsomeres (0.23: 0.24). Hind femur 0.8 × longer than fore tibia (0.6: 0.8) Basal spur on hind tibia 0.4 × longer than hind basitarsus (0.11: 0.3). Hind basitarsus 0.9 × longer than combined length of second to fourth tarsomeres (0.3: 0.34).

Wings. Fore wing length 2.7 × longer than its width (2.82: 1.05) (Fig. 4 D View Figure 4 ). Pterostigma 3.2 × longer than its width (0.58: 0.18). 1 RS as long as (RS + M) b vein. (RS + M) b vein present, 0.2 × longer than 2 RS (0.05: 0.28). r 0.6 × longer than 2 RS (0.16: 0.28). 3 RSa 1.8 × longer than r (0.29: 0.16). 3 RSb reaching wing margin as a tubular vein. r-m present as tubular vein medially. 2 nd submarginal cell trapezoid seemingly with two right angles apically (Fig. 4 D View Figure 4 ). 3 M reaching wing margin as a tubular vein. 3 CU reaching wing margin as a tubular vein. Apical angle between mc-u and 2 Cua approximately 120 ˚. Hind wing RS and M strongly developed, not reaching wing margin (Fig. 4 D View Figure 4 ). M + CU 0.5 × longer than 1 M (0.27: 0.58). m-cu crossvein absent. cu-a entirely developed. 1 A vein present not reaching wing margin.

Metasoma. Metasoma mostly polished and setose with long pale setae. Tergum 1 nearly rectangular (Fig. 4 B View Figure 4 ); Y-shaped suture on tergum 1 present and crenulate (Fig. 4 B View Figure 4 ); spiracle of tergum 1 located at basal third. Suture between tergum 2 and tergum 3 deep and finely granulose (Fig. 4 C View Figure 4 ). Tergum 2 1.6 × longer than tergum 3 medially (0.34: 0.22); spiracle of tergum 2 located at basal third. Setose part of ovipositor sheath as long as hind femur and 0.8 × longer than hind tibia (0.6: 0.8). Ovipositor slightly curved.

Color. Body mostly polished black. Setae on body whitish to ivory. Antenna mostly dark brown; annellus brown. Face dorsomedially bright brown to yellow. Malar space brown. Mandibles mostly yellow. Wings mostly slightly infuscate. Pterostigma entirely brown. Legs mostly brown. Fore tarsus bright brown. Trochantelli mostly yellow. Tibial spurs yellow. Mesosternum mostly ivory. Ovipositor yellow.

Host insects.

Anoplophora glabripennis (Motschulsky, 1853) , Monochamus alternatus Hope, 1842 (new host record).

Distribution.

China, Korea (GG, GN, Jeju (new record )), Russia (Far East).

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Braconidae

Genus

Doggerella

SubGenus

Lelejobracon

Loc

Doggerella (Lelejobracon) chasanica ( Tobias, 2000 )

Kim, Moo-Sung, Kim, Il-Kwon, Sharkey, Michael & Kang, Ilgoo 2025
2025
Loc

Doggerella (Lelejobracon) chasanica ( Tobias, 2000 ), in Samartsev et al. 2024: 198 .

Samartsev KG & Ku D-S & Lee H-R & Kwon G-M 2024: 198
Doggerella (Lelejobracon) chasanica ( Tobias, 2000 ), in Samartsev et al. 2024: 198 .
2024
Loc

Bracon planitibiae Yang, Cao & Gould, 2019 , in Cao et al. 2019: 430 .

Cao LM & Wang XY & Gould JR & Li F & Zhang YL & Yang ZQ 2019: 430
Bracon planitibiae Yang, Cao & Gould, 2019 , in Cao et al. 2019: 430 .
2019
Loc

Doggerella (Lelejobracon) chasanica ( Tobias, 2000 ), in Samartsev 2019: 54 .

Samartsev KG 2019: 54
Doggerella (Lelejobracon) chasanica ( Tobias, 2000 ), in Samartsev 2019: 54 .
2019
Loc

Doggerella (Lelejobracon) chasanica

Samartsev KG 2016: 124
2016
Loc

Bracon chasanicus

Tobias VI & Belokobylskij S 2000: 148
Bracon chasanicus Tobias, 2000 , Belokobylskij and Tobias 2000: 148 .
2000
Loc

Bracon bitumor

Bracon bitumor Papp, 2018: 26 .