Cecropterus (Thorybes) notochlorothrix Grishin, 2025

Cecropterus (Thorybes) notochlorothrix Grishin , new species

http://zoobank.org/ F47CF66E-9C31-4CBB-8789-B5F42D7DEC04 ( Figs. 53 View Fig part, 54, 55a–b)

Definition and diagnosis. In addition to Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “Cayenne” [ French Guiana?]) and Cecropterus (Thorybes) chlorothrix (Röber, 1925) , stat. rest. (type locality Peru: Pasco, Huancabamba), genomic analysis reveals a third clade in this group genetically differentiated from the others at the species level ( Fig. 53 View Fig ). This clade is sister to C. virescens in the nuclear genome (autosomes) tree ( Fig. 53a View Fig ) but is sister to C. chlorothrix in the Z chromosome ( Fig. 53b View Fig ) and the mitochondrial genome trees ( Fig. 53c View Fig ). Its Fst / Gmin /COI barcode difference are 0.23/0.005/2.0% (13 bp) (from C. virescens ) and 0.17/0.012/1.4% (9 bp) (from C. chlorothrix ). Therefore, this clade represents a new species. This new species keys to “ Urbanus virescens ” (C.13.27) in Evans (1952) but differs from its relatives by the following combination of characters: a distally rounded harpe ( Fig. 55a View Fig ) (more pointed in C. chlorothrix ) without the distal and central broad projections of C. virescens ( Fig. 55e, f View Fig ) and with a narrower dorsal projection similar to that in Cecropterus (Thorybes) viridissimus Grishin, 2023 (type locality in Ecuador), which in addition possesses dull distal and central projections; slightly thicker and shorter uncus arms ( Fig. 55a View Fig vs. c) that are more strongly diverging ( Fig. 55b View Fig vs. d); a straighter dorsal surface of the tegumen and a more angled anteriad (vs. rounder) central bend in the vinculum in lateral view ( Fig. 55a View Fig vs. c); a narrower forewing and a more elongated towards the tornus hindwing; generally darker facies, narrower semi-hyaline white spots and bars on the forewing, especially the subapical spots, and typically stronger overscaled with brown (within the white marginal band) apex of the ventral hindwing. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly11426.2.3:C135G, aly11426.2.3:G141A, aly11426.2.3:C153A, aly18826.19.9:G42A, aly18826.19.9:C75T; and COI barcode: T82C, A109G, A217G, T274C, 400A, 517C. Barcode sequence of the holotype. Sample NVG-14111A02, GenBank PV550006, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAGATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGGGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCCTCCTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 54 View Fig , bears the following three printed (text in italics handwritten) rectangular labels, two white: [ BRAZIL: Sta Catarina | Joinville, 0–200m | 26 O 19'S 48 O 53'W | 28.X.1989 | leg. H. Miers], [DNA sample ID: | NVG-14111A02 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | notochlorothrix Grishin] GoogleMaps . Paratypes: 4♂♂ from Brazil: 1♂ NVG-14111A03 Minas Gerais, Viçosa , 650 m, approx. GPS −20.750, −42.867, 9.II.1990, H. Miers leg. [ USNM] and GoogleMaps São Paulo, São Paulo, D. L. Lindsley leg. [ MGCL] GoogleMaps : 1♂ NVG-24124A07 13-Aug- 1960, genitalia NVG250517-04 ( Fig. 55a–b View Fig ) and 2♂♂ 26-Feb-1961: NVG-24124A08 and NVG-24124A09.

Type locality. Brazil: Santa Catarina , Joinville, elevation 0–200m, approx. GPS −26.3167, −48.8833.

Etymology. In Greek, νότιος (notios) means southern. This modified prefix is added to the name of a relative of the new species, C. chlorothrix , which itself is a composite of two Greek words: χλωρός (chloros) for green and θρίξ (trix) for hair, literally meaning green-haired. The name is treated as a noun in apposition.

Distribution. Currently known from Southeast and South Brazil.