Cecropterus (Thorybes) virescens (Mabille, 1877)
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16807103 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B3C-724B-FE8B-FFFEABF2FDBD |
treatment provided by |
Felipe |
scientific name |
Cecropterus (Thorybes) virescens (Mabille, 1877) |
status |
|
Cecropterus (Thorybes) chlorothrix (Röber, 1925) is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877)
Genomic analysis of Eudamus chlorothrix Röber, 1925 (type locality Peru: Pasco, Huancabamba, holotype sequenced as NVG-18094D06), currently treated as a junior subjective synonym of Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “Cayenne” [ French Guiana?], syntype sequenced as NVG-15029F10), reveals that the two taxa are genetically differentiated at the species level ( Fig. 53 View Fig ); e.g., their Fst/Gmin/COI barcode difference are 0.18/0.012/2.3% (15 bp). Therefore, we propose that Cecropterus (Thorybes) chlorothrix (Röber, 1925) , stat. rest. is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877) . The COI barcode sequence of the holotype of C. chlorothrix , sample NVG-18094D06, GenBank PV550005, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCGGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGGGCCATTACTATACTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Eudaminae |
Tribe |
Eudamini |
Genus |