Clytius mattus, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 25-27

publication ID

2643-4806

persistent identifier

https://treatment.plazi.org/id/E87A9B1F-9A60-8519-FDC2-2BA060A19021

treatment provided by

Felipe

scientific name

Clytius mattus
status

new species

Clytius mattus Grishin, new species

http://zoobank.org/ DD29A886-8DAF-4083-AA50-0BD745320AFC ( Figs. 27 part, 28–29, 30 part)

Definition and diagnosis. Genomic analysis of Clytius Grishin, 2019 (type species Pholisora clytius Godman & Salvin, 1897 ) reveals a clade that does not have an available name associated with it ( Fig. 27). These specimens are genetically differentiated from others at the species level, e.g., Fst / Gmin /COI barcode differences are 0.27/0.00/0.5% (3 bp) (from Clytius unifascia (Mabille, 1889) , comb. nov., stat. rest.), 0.40/0.009/2.1% (14 bp) (from Clytius clytius (Godman & Salvin, 1897)) , and 0.36/0.005/0.9% (6 bp) (from Clytius semitincta (Dyar, 1924) , stat. rest.). Therefore, they represent a new species. Although COI barcodes are only weakly different between some of these species, nuclear genome trees ( Fig. 27a, b) and statistics substantiate their species status. This new species keys to “ Bolla clytius ” (E.31.22) in Evans (1953) and was included in this species. The new species differs from its relatives by the following combination of characters: more uniform coloration, frequently without defined bands and only somewhat darker in the basal half of wings, usually one or two forewing subapical spots and maybe a small spot by the base of the cell CuA 1 -CuA 2, and narrower male genitalic valva with longer harper and more expanded, less concave ampulla ( Figs. 29, 30). Due to the relatively cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.132.2:A330G, aly444.7.11:C138T, aly 2879.4.2:C58T, aly 1118.1.4:C60T, aly 1118.1. 4:C94T, and COI barcode: A28G, T49C, T74T, T640T, T641C (the barcode may not differ from C. unifascia ). Barcode sequence of the holotype. Sample NVG-

5486, GenBank PQ489708, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGGTCTGGTATAGTAGGAACTTCCTTAAGTATA

TTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATA

ATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTAT

AATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCT

TTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAA

TTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTT

ATCAGCTAATATTGCTCATCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCTTTACAT

TTAGCTGGAATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATA

TGCGAATTAATAATTTATCTTTCGATCAAATACCTTTATTTGTATGAGCTGTGGGAAT

CACAGCTTTACTTTTACTTTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTT

TTAACTGATCGAAATCTTAACACGTCTTTTTTTGACCCTGCTGGTGGAGGAGATCCTA

TTCTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the

Texas A&M University Insect Collection, College

Station, TX, USA ( TAMU), illustrated in Fig. 28

(genitalia in Fig. 29), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ TEXAS: | Hidalgo County |

Bentsen-Rio Grande | Valley State Park | south of

Mission], [coll. | 18 Oct 19 75 | Edward C. Knudson], [ HESPERIIDAE , | Pyrginae : | Bolla clytius ( God. & Salvin, 1897, | ♂ det. R. O. Kendall | M. & B. No. 66], [DNA sample ID: | NVG-5486 | c/o Nick V. Grishin ], [genitalia | NVG160110-27 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clytius mattus | Grishin ]. Paratypes: 18♂♂ and 15♀♀: 1♀ NVG-7691 the same data as the holotype, genitalia vial NVG170108-22 ; USA: Texas, Hidalgo Co, W. W. McGuire leg., first US record [ TAMU]: 1♀ Santa Ana National Wildlife Refuge , 17-Oct-1973, 1♂ and 1♀ Abrams , 18-Oct-1973, and 1♀ Relampago at USH281 21-Oct-1973; and Mexico: Tamaulipas: 1♂ NVG-17108F04 40 mi E of Ciudad Victoria, 21- Oct-1974, W. W. McGuire leg. [ LACM] and Roy O. Kendall & C. A. Kendall leg., [ TAMU]: El Nacimiento , Rio Mante : 1♂ NVG-7692 21-Jan-1974, genitalia vial NVG170108-23 , 3♂♂ 18-Feb-1974, and 1♀ 10-Nov-1974; 1♂ and 3♀♀ 28 km S of San Fernando, 16-Dec-1973; Sierra Cuchara , near rock quarry: 2♂♂ 17-Feb-1974 and 2♂♂ 24-Feb-1974; and 2♂♂ and 1♀ Rancho Pico de Oro , vicinity of Los Kikos , 22-Feb-1974; San Luis Potosi: 1♂ NVG-15111G12 Ciudad Valles , 18-Jun-1974, H. A. Freeman leg. [ AMNH] and ca. 16 km E of Ciudad Valles, Hotel Taninul , Roy O. Kendall & C. A. Kendall leg. [ TAMU]: 1♂ 4-Feb-1980 and 1♀ NVG-7693 30-Jan-1980, genitalia vial NVG170108-24 ; Veracruz: 1♂ NVG-15111G11 near Paraje Nuevo , Hacienda Potrero Viejo , 5-Jun-1981, J. & R. Potts leg., genitalia slide G1705 [ AMNH] and all the rest in USNM, no dates known unless specified: 1♂ Xalapa ; 1♀ La Gloria , Cardel, J. Camelo G. leg.; 1♀ Tlacotalpan , 29-Jul-1897; and W. Schaus collection: 1♂ Paso San Juan , 1♀ Coatepec , and 1♀ NVG-7181, USNMENT_01321029 Orizaba, genitalia vial NVG161005-08 ; and 1♀ NVG-18049H08, USNMENT_01466670 Oaxaca, Tuxtepec, Camelo leg.

Type locality. USA: Hidalgo Co., Bentsen-Rio Grande Valley State Park .

Etymology. The name is formed from the word matte and is given for the dull, matte colors of this species. The name is a Latinized masculine adjective.

Distribution. From the lower Rio Grande Valley in South Texas, USA, to Veracruz and Oaxaca, Mexico. The southern limits of the range remain to be investigated.

Suggested English name. Matte Sootywing.

Comment. We note that two species of Clytius have been recorded in the USA: C. clytius in Arizona and C. mattus sp. n. in Texas, confirmed by genomic sequencing ( Fig. 27).

A nomen nudum Pholisora elis in J. B. Smith et al., 1891 refers to a specimen of Clytius clytius (Godman & Salvin, 1897) from USA: Arizona

The name Pholisora elis in Smith et al. (1891) is a nomen nudum (no description or indication published, just the name listed) of currently unknown attribution (Mielke 2005). A specimen labeled as a type of “ Pholisora Elis Edw. ” collected in “S. W. Arizona” was found in the USNM collection ( Fig. 31). It bears the label “ Pho. Elis ♀ | Ariza” in Edward’s handwriting, which supports the authenticity of this specimen as a reference for the name. Genomic sequencing of this specimen places it among Clytius clytius Godman & Salvin, 1897 (type locality in Mexico: Nayarit, Tres Marias Island), closest to another specimen collected in Arizona and a specimen from Mexico: Sonora ( Fig. 27), thus supporting its collecting locality in the USA. Therefore, we propose to list Pholisora elis of J. B. Smith et al., 1891, nom. nud. in synonymy with Clytius clytius Godman & Salvin, 1897 . Because the name P. elis is unavailable, it does not formally have type specimens, and the specimen labeled as “Type” is not a syntype but a regular specimen, a male, that helps us refine the synonymic placement of this name. The COI barcode sequence of this specimen, sample NVG-22035A10, GenBank PQ489709, 658 base pairs is: AACTTTATACTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGCTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCACCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTCGATCAAATACCTTTATTCGTATGAGCTGTAGGAATCACAGCTTTACTTTTACTTTTATCTCTGCCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGACCGAAATCTTAATACAT CTTTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

TAMU

Texas A&M University

R

Departamento de Geologia, Universidad de Chile

V

Royal British Columbia Museum - Herbarium

LACM

Natural History Museum of Los Angeles County

AMNH

American Museum of Natural History

USNM

Smithsonian Institution, National Museum of Natural History

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

Genus

Clytius

Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF