Damas kenos Grishin, 2025
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16805978 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BC1-72B7-FDBB-F93FAD96FB19 |
treatment provided by |
Felipe |
scientific name |
Damas kenos Grishin |
status |
new species |
Damas kenos Grishin , new species
http://zoobank.org/ F274D8A9-4E44-4704-84BF-C1AAF9939812 ( Figs. 148d View Fig , 149j–k View Fig , 152 View Fig part, 153 part)
Definition and diagnosis. Several specimens from the Amazonian region are genetically differentiated from other Damas Godman, 1901 ( type species Goniloba clavus Herrich-Schäffer, 1869 ) at the species level, forming a separate clade sister to several other species in the genus ( Fig. 152 View Fig orange) and, therefore, represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955) but differs from all its congeners by the combination of the following characters in males: the lack (or a trace) of the discal cell spot on the forewing, narrower brand (with the 3 rd small dot-shaped segment in the middle of the cell CuA 2 -1A+2A, only slightly longer (along the CuA 2 vein) than wide brand segment below the CuA 2 vein, nearly triangular semi-hyaline spot in cell CuA 1 -CuA 2 with only slightly concave outer margin; dark ventral hindwing with little purple gloss, only slightly paler area towards the inner margin of dorsal forewing with a diffuse cream spot (smaller than the spot in the cell CuA 1 -CuA 2) in the middle of the cell CuA 2 -1A+2A, more extensive on the underside; one small subapical spot; head brownish-gray, including ventral side of the palpi and cheeks. Due to the somewhat cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly318.43.4:A87G, aly318.43.4:T117C, aly686.10.2:T42G, aly686.10.2:A63G, aly4740.1.1:C969T; and COI barcode: A79G, T82C, T106C, A331G, T428C.
Barcode sequence of the holotype. Sample NVG-23078E10, GenBank PV550071, 658 base pairs: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGGAACCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGGACTGTTTACCCCCCTCTTTCCTCCAATATTGC CCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTCTAGGAGCAATCAATTTTATTACTACAATCATTAATATACGAGTAAGAAACTTATCC TTTGATCAAATACCATTATTTATTTGATCAGTAGGAATTACAGCTCTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 148d View Fig , bears the following four printed rectangular labels, three white: [ Iquitos | Amazon. Sup. | 1892. Michael], [Coll. Staudinger], [DNA sample ID: | NVG-23078E10 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Damas kenos | Grishin ]. The holotype was collected in 1892 by Otto Michael. Paratypes: 4♂♂ and 1♀: Peru, Madre de Dios, Tambopata Reserve: 1♂ NVG-23123B06 Rio la Torre , 1-Oct-1986. S. S. Nicolay leg., genitalia NVG240817 -70 ( Fig. 149j, k View Fig ) [ USNM] and 1♀ NVG-24099C08 60 km S of Puerto Maldonado, Rio Tambopata , 25-Oct-1999, D. & J. Lindsley leg. [ MGCL] and Brazil, Pará: 1♂ NVG-24099D08 Santarem , ex coll. Le Moult; 1♂ NVG-21118A09 1886, Donckier leg. [ MFNB] and 1♂ NVG-18056H09 " Amaz. Inf. " P. Hahnel leg. [ ZSMC] . The last specimen is labeled as a “ paratype ” of Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí). However, it is not from the type locality and, therefore, is not a syntype of that taxon.
Type locality. Peru: Loreto Region, Iquitos .
Etymology. In Greek, κενός (kenos) means empty or void and is given for the lack of a pale spot in the discal cell of the forewing in this species. The name is treated as an indeclinable adjective.
Distribution. The Amazonian region from north-eastern Peru to the lower Amazon.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Hesperiinae |
Tribe |
Hesperiini |
Genus |
|
SubGenus |
Ochluma |