Disphragis bifurcata Sullivan & Pogue

Sullivan, J. Bolling & Pogue, Michael G., 2014, The Disphragis notabilis (Schaus) species-group in Costa Rica (Lepidoptera, Notodontidae), ZooKeys 421, pp. 21-38 : 22-24

publication ID

https://dx.doi.org/10.3897/zookeys.421.7351

publication LSID

lsid:zoobank.org:pub:4B87F05B-1916-404E-B3E1-ECF514708A88

persistent identifier

https://treatment.plazi.org/id/0944967F-1CB1-48C6-9702-0B8FA0D8E9B9

taxon LSID

lsid:zoobank.org:act:0944967F-1CB1-48C6-9702-0B8FA0D8E9B9

treatment provided by

ZooKeys by Pensoft

scientific name

Disphragis bifurcata Sullivan & Pogue
status

sp. n.

Taxon classification Animalia Lepidoptera Notodontidae

Disphragis bifurcata Sullivan & Pogue sp. n. Figs 1, 10, 14, 18, 22

Type material.

Holotype male: Costa Rica, Reserva Hitoy Cerere ( 9.404°N, 83.015°W), Limon Province, 354', 1-4 July 2008, J. Bolling Sullivan. INBio. Paratypes: 11♂, 3♀: 4♂, same data as holotype (JBS-2094, JBS-3053); 1♀, 22 March 2003, Monty Wood (JBS-3030); 1♂, Costa Rica, Est. Biol. La Selva ( 10.26°N, 84.01°W), Heredia Province, 50-150 m, 21-30 June 2003, Monty Volovsic (JBS-3040), 2♂, 29 Aug. -2 Sept. 2003, J. Bolling Sullivan (JBS-3038); 2♂, Costa Rica, Upata Estacion San Gerardo ( 10.89°N, 85.38°W), Alajuela Province, 550 m, 17-21 July 2006, J. Bolling Sullivan, B. Espinosa (JBS-3035); 1♂, Costa Rica, Puriscal Chires, Mastatal (N9.411; W-84.220), San Jose Province, 400 m, 16-18 Oct. 2011, J. Bolling Sullivan; 1♂, Costa Rica, Verugua Rainforest Campamento ( 9.553°N, 83.112°W), Limon Province, 400-500 m, 12-16 March 2010, J. Bolling Sullivan (11-CRBS-2066), (JBS-5427); 1♀, Costa Rica, Tuis, 2500', June, W. Schaus 1910-110. (BM-); 1♀, Costa Rica, Cashi, 8-10 1912 (Lankester), Rothschild Bequest, B. M. 1939-1. (BM-). (USNM, BMNH, JBS, INBio)

Etymology.

The name bifurcata refers to the bifurcate tip of the socii, which is diagnostic.

Diagnosis.

Maculation characters can usually be used to separate Disphragis bifurcata and Disphragis notabilis from the other two members of the complex. Forewing color is a warm brown, not mottled or brownish gray as in Disphragis sobolis and Disphragis hemicera . Additionally, the male antennal pectinations are shorter in Disphragis bifurcata and Disphragis notabilis . Males of Disphragis bifurcata are easily distinguished by the large upturned and bifurcated socii in the male genitalia. In males of Disphragis notabilis the socii usually have a single point at the apex, with many spines arising from the ventral edge. Females must be identified by maculation and geography; Disphragis bifurcata occurs in Central America and central and western Colombia.

Description.

Male. (Figs 1, 10) Head -labial palps upturned, mahogany brown on basal segment, medial segment with cream scaling along distal margin, particularly near the terminus, and apical segment mostly cream scaled with scattered brown scales. Denuded medial segment 2.4 × length of apical segment. Eye round, large, surrounded tightly with scaling. Front scaling mostly cream with scattered brown scales. Vertex with additional brown scales among white scaling. Scape with cream and brown scaling, cream extending onto antennal shaft for about 10-14 segments. Antenna bipectinate basally for 30 segments, then with minute basal seta on segments to tip (68 segments). Longest rami 0.44 mm. Thorax a blend of fine brown and cream scales giving a tan appearance. Metathorax bearing a central white spot with row of darker brown scales anteriorly. Abdomen with appressed brown scaling. Forewing (17.5 mm N = 10) elongate, rounded apically and with broad tan subcostal streak from base of wing to apex. Streak encloses chocolate reniform spot and has several slightly darker brown lines crossing obliquely from costa. Basal dash below streak paralleling costa. White streak below basal dash; warm brown patch distal to white streak bordered by white; wavy antemedial (AM) and postmedial (PM) lines. Chocolate shading from middle of forewing below costal streak and forming a wedge to margin (below costal streak to anal angle). Weak gray crescent on lower half of margin. Hind wing fuscous with darker margin and veins, weak darker brown anal markings almost a spot at anal angle. Underside of forewing fuscous, anal margin and cell yellowish. Basal 3/4 of hind wing yellowish, margin brown and well differentiated. Legs a mixture of brown and white scales, appearing almost yellowish, with white scales forming rings at distal end of tarsal segments. Tibial spines 0-2-4. Male genitalia (Figs 14, 18) (8 dissections). Uncus an extended triangle, apex rounded with setae arranged almost in marginal rows. Tegumen broad, longer than vinculum. Socii extending from base of uncus as two large upcurved arms, scythe-like, apex bifurcate. Occasionally tip may be subdivided farther with arrowhead-like plates embedded near apex (visible at higher magnification). However, plates do not form ventral spine-like projections as in Disphragis notabilis . Gnathos absent, anal tube membranous. Valva elongated with costal half sclerotized, anal half membranous and enveloping deciduous scent hairs. Valva apex rounded, sclerotized costal half of valva with broad anal projection distally and sharper but rounded and more heavily sclerotized projection basally. Vinculum broad, short, rounded to saccus. Phallus long, narrow with subbasal keel, proximal half unsclerotized, ductus entering medially. Distal half of phallus sclerotized, enlarged basally at junction with membranous half, and with small teeth-like spines ventrally and laterally on basal half. Vesica emerges dorsally from aedeagus, forming a membranous tube that turns to parallel aedeagus and then to left with no major diverticula. A lightly sclerotized sliver-like cornutus often visible and often with small peg-like cornuti where vesica turns left. Eighth tergite broadly rounded, slightly sclerotized and crenulated medially at distal end. Eighth sternite lightly sclerotized, broadly rounded with well-defined, broad notch medially. Small sac-like flap in middle of sclerite, anterior end of sclerite with two broad, rounded projections with medial V-shaped notch. Ctenophores absent. Female. (Fig. 10). Female similar to male only larger (Forewing 21.3 mm, n = 3) and with fasciculate antennae. Female genitalia (Fig. 22) (3 dissections). Papillae anales bluntly rounded, slightly setose. Extension of 9th tergite forming dorsal flap. Anterior apophysis short, 25% as long as posterior apophysis. Genital plate small, elongate, consisting of a bifurcated middle phalanx with lateral “wings” from base. Ductus bursae slightly shorter than corpus bursae, narrow and tending to twist, unsclerotized. Corpus bursae egg shaped, with large signum on dorsal surface. Signum shield-like, about half as long as corpus bursae. Signum egg shaped with stippled lateral flanges anterior to midpoint. Proximal margin lightly sclerotized and faintly stippled.

DNA barcode sequence.

Five barcoded specimens exhibit two haplotypes that differ from each other by a maximum of 0.15%. They differ from Disphragis hemicera by a minimum of 5.61%, from Disphragis notabilis by a minimum of 1.26%, and from Disphragis sobolis by a minimum of 5.78%. The most common haplotype (11-CRBS-2066) is:

AACCTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTCTTCTAATTCGTGCTGAATTAGGAACCCCCGGGACTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGACATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTTTAATACTTTTAATTTCGAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCACTGTCATCTAATATTGCTCATAGAGGAAGCTCTGTTGATTTAGCCATTTTTTCCCTTCACTTAGCTGGTATTTCATCAATTTTAGGGGCTATTAATTTTATCACAACAATTATTAATATACGATTAAATAATATATCTTTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACTGCTTTTTTACTTTTACTTTCTCTCCCAGTTCTAGCTGGAGCTATTACTATACTTTTAACTGATCGTAATTTAAATACATCTTTTTTTGACCCTGCAGGGGGAGGAGATCCTATTTTATACCAACATTTATTT

Distribution.

Known from Guatemala to Colombia (Anchicaya, Valle, and the Magdalena Valley), and probably extending south into northern Ecuador.

Remarks.

This species occurs at lower altitudes and moderate elevations (1000 m) where it occurs with Disphragis hemicera .

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Notodontidae

Genus

Disphragis