Emesis ( Mandania ) russula sudesta, Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024

Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024, Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae), Insecta Mundi 2024 (82), pp. 1-48 : 10-12

publication ID

https://doi.org/10.5281/zenodo.14662420

publication LSID

lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C

persistent identifier

https://treatment.plazi.org/id/03BF8783-FF87-FFC3-FF21-F9369A4BF9B9

treatment provided by

Felipe

scientific name

Emesis ( Mandania ) russula sudesta
status

new subspecies

Emesis ( Mandania) russula sudesta Grishin, new subspecies

http://zoobank.org/ 0FDAEBAB-A780-403B-B1F8-1F4C772A15D6

( Fig. 2 View Figure 2 part, 19–22, 85–88)

Definition and diagnosis. As discussed above, Emesis russula Stichel, 1910 ( type locality in Boliv ia: La Paz,

Farinas) populations partition into two subclades that we define as subspecies ( Fig. 2 View Figure 2 green and brown). Their COI barcodes differ by 1.2% (8 bp). The lectotype designation assigns the nominate subspecies to the northwestern populations of E. russula from the Andes, and the southeastern subspecies is new. This new subspecies differs from the nominotypical subspecies by more developed and darker pattern elements on the wings’ dorsal side that is somewhat redder in color, usually without purplish gloss, and the ventral side is typically with heavier reddish markings. Due to unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne5853.5.7:C70T, cne12666.1.11:T552C, cne 2259.5.9:A147C, cne6241.3.5:G24A, cne4342.8.1:A349T. However, the COI barcode may not differentiate between subspecies due to introgression. We hypothesize this because, in the specimens we sequenced, the barcode of the new subspecies is more similar to Emesis ( Mandania) mandana (Cramer, 1780) (type locality in Suriname) than to its closer relative E. russula russula ( Fig. 2c View Figure 2 brown to blue rather than brown to green). Therefore, these barcodes likely represent a later introgression event rather than the original barcodes of the new subspecies. It remains unclear if the introgression is complete, and these E. mandana -like barcodes are present in all specimens of the new subspecies (less likely), or if the original, E. russula -like barcodes are still present in some individuals of the new subspecies (more likely). In our current dataset, the two subspecies differ in their COI barcodes, and the COI barcode corresponding to the new subspecies is diagnosed by a combination of the following base pairs A34A, T136T, C220C, T397T, A412G, C421C. However, if some specimens of the new subspecies possess barcodes similar to those of the nominate subspecies, they may not be identifiable by barcodes.

Barcode sequence of the holotype. Sample NVG-18044D12, GenBank PQ203550, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCGGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♀ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 19–20 View Figures 7–26 , bears the following six rectangular labels (3 rd blue, the last red, and others white; 2 nd handwritten, others printed with handwritten text marked in italics): [ BRAZIL: PR | 30 km NW Ponta | Grossa, 900m | 24 O 57’S 50 O 28’W | 19 Mar 1991 | Robbins, Mielke & | Cassagrande, leg.], [russula], [ JHALL | -00 02], [DNA sample ID: | NVG-18044D12 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01466367], and [ HOLOTYPE ♀ | Emesis (Mandania) russula | sudesta Grishin ]. Paratypes: 4♂♂ and 3♀♀: Paraguay [ USNM]: 1♂ NVG-18045H11 (leg), NVG-23114G06 (abdomen), USNMENT 01466507, genitalia vial NVG240817-11 ( Fig. 21–22 View Figures 7–26 , 85–86 View Figures 81–106 ) and 1♀ NVG-18044F07 (leg), NVG-23114G07 (abdomen), USNMENT 01466386 from Sapucaí, old (around 1900), W. T. Foster leg., genitalia vial NVG240817-12 ( Fig. 87–88 View Figures 81–106 ) and 1♂ NVG-18044E10, USNMENT 01466377 Paraguarí Department, 25 km SE of Ybycui, Ybycui National Park, 12-24-Apr-1980, P. J. Spangler et al.; Brazil, Paraná [ USNM]: 1♂ NVG-18045H10, USNMENT 01466506 Castro, old, W. Schaus collection [ USNM] and 1♀ NVG-18045A07, USNMENT 01466420 the same data as the holotype; 1♀ NVG-18052C12, paralectotype of E. russula , Brazil, “S. Leopoldina” or “S. Leopoldo” [ MFNB]; and 1♂ NVG-18039G06 Argentina: Buenos Aires, old, Strecker collection, No. 9477 [ FMNH].

Type locality. Brazil: Paraná, 30 km northwest of Ponta Grossa, elevation 900 m, GPS −24.950, −50.467.

Etymology. The name russula possibly originated from the Latin word russus, which means reddish, although the color of this species is less red than that of E. mandana . In Portuguese, sudeste means southeast, and the name is given for the southeastern distribution of this subspecies compared to the nominate. The name is treated as a feminine noun in apposition.

Distribution. Recorded from southern Brazil (e.g., Paraná), Paraguay, and northeastern Argentina.

Comment. We conservatively propose this new taxon as a subspecies due to its small genetic differentiation, especially in the Z chromosome ( Fig. 2b View Figure 2 ), and limited phenotypic distinction. To aid future comparisons, we illustrate the genitalia of the nominate E. russula male NVG-18044D11 (leg), NVG-23114G08 (abdomen), USNMENT 01466366 from Bolivia: La Paz, Chulumani, 600 m, GPS- 16.400, -67.517, 27-May-1989, C. Covell leg., genitalia vial NVG240817-13 [USNM] ( Fig. 89–90 View Figures 81–106 ), which may have less robust valvae with narrower upper and lower projections. We note that considering generally small genetic differences among species of Emesis ( Mandania) , it is possible that future research may demonstrate that the new subspecies described here is a species-level taxon.

USNM

Smithsonian Institution, National Museum of Natural History

V

Royal British Columbia Museum - Herbarium

T

Tavera, Department of Geology and Geophysics

MFNB

Museo Friulano di Storia Naturale

FMNH

Field Museum of Natural History

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Riodinidae

Genus

Emesis

Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF