Emesis (Poeasia) sonorensis, Grishin, 2024

Emesis (Poeasia) sonorensis Grishin, new species

http://zoobank.org/ 536E5AFC-C7D0-4BE4-8020-6C3473916B3B

( Fig. 4 View Figure 4 part, 53–54, 111–112)

Definition and diagnosis. Genomic analysis reveals that specimens from Mexico identified as Emesis (Poeasia) poeas Godman, 1901 (type locality in Mexico: Guererro, lectotype sequenced as NVG-18081G07, NHMUK_010430896) partition into two clades ( Fig. 4 View Figure 4 purple and green) genetically differentiated from each other at the species level, e.g., their COI barcodes differ by 1.8% (12 bp). One clade includes the lectotype of E. poeas , while the other one, more northern in distribution, corresponds to a new species. This new species is phenotypically similar to E. poeas and differs from it by being, on average, smaller, darker, and with a less contrasting pattern, i.e., more uniformly colored with weaker defined alternating grayer and more saturated in color reddish bands, and ventrally yellower orange rather than browner as E. poeas . In male genitalia ( Fig. 111–112 View Figures 107–132 ), valvae are less robust than in E. poeas ( Fig. 113–114 View Figures 107–132 , NVG-23111B11 Mexico: Oaxaca, Rt. 200 at Rio Huamelula, 16-Jul- 1981, D. S. Bogar, J. C. Schaffner, and T. P. Friedlander leg. [CMNH]), the lower projection is stronger curved inward and terminally less rounded, the upper projection is laterally narrower and more curved dorsad; the posterior lobe in the middle of vinculum is larger, plate-like, trapezoidal, with more concave posterior margin. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne213.6.1:A360G, cne562.20.2:A522C, cne896.9.8:G42A, cne3178.4.9:C6A, cne3178.4.9:T9C, and COI barcode: T212T, C235T, T250T, A382A, T418T.

Barcode sequence of the holotype. Sample NVG-18044G03, GenBank PQ203559, 658 base pairs: AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAGGATCTTTAATT GGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTCTTATATTAGGAGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTATTTTTATTAAT TTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTA GCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGTATTAATAATATATCAT TTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATT AACTGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGTGGTGGAGACCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 53–54 View Figures 49–62 , bears the following six printed rectangular labels, five white: [ Riodinidae IX-23-1987 | Emesis poeas M | Tepoca, Sonora, Mexico | Leg: John Kemner], [DNA sample ID: | NVG-18044G03 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H04 | c/o Nick V. Grishin ], [genitalia | NVG240817-22 | Nick V. Grishin ], [USNMENT | {QR Code} | 00940216], and one red [HOLOTYPE ♂ | Emesis (Poeasia) | sonorensis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2♀♀: NVG-18044G04, USNMENT 00940173 the same data as the holotype and NVG-18052H06 “Texas” Fruhstorfer, H. Stichel collection No. 3304 [ MFNB]. The locality of the last paratype is most likely in error.

Type locality. Mexico: Sonora, Tepoca.

Etymology. The name is formed from the name of the state with the type locality and is a feminine adjective.

Distribution. Currently known only from Sonora in Mexico.