Hermeuptychia occidentalis Grishin, 2021

Hermeuptychia occidentalis Grishin , new species

http://zoobank.org/ 7FB00257-D9A6-4C25-930B-78145BF3AFAC

( Figs. 11– 18 View Figs , 33e–i, l, m View Fig , 36 View Fig part)

Description and diagnosis. Belongs to the same species group with Hermeuptychia sosybius ( Fabricius, 1793) and Hermeuptychia hermybius Grishin, 2014 as judged by the presence of large areas on the dorsal surface of the wings covered with androconia, morphology of the male genitalia and COI DNA barcodes that place this species as sister to the two others ( Fig. 36 View Fig ). Due to wing pattern variation, identification by facies is challenging. Characterized by a postmedian area on the ventral hindwings distad of the distal median line and to the eyespots (sometimes beyond them) paler than the rest of the wing, and markedly paler than the discal area forming a (somewhat) darker band bordered by the two median lines. The forewings in most specimens show the same, but weaker, tendency of being paler towards the outer margin from the distal median line. Veins not paler than the background, as they frequently are in H. hermybius . Diagnosed by genitalia and COI barcodes. In male genitalia ( Fig. 33e–i View Fig ), which are otherwise similar to H. hermybius , the uncus is narrower, lanceolate in dorsal view, being broadest near its basal third, rather than near or past its middle, not constricted before the truncated apex, the apex narrower as well. In the female genitalia ( Fig. 33l, m View Fig ), the antrum is broader, nearly round, broadest near its middle, nearly symmetrical. The following combination of characters in the COI DNA barcode is proposed as diagnostic: T5C, T247C, T484C, T580C, T583C, and T646C, where the number refers to the sequence given below (from 1 to 658), the letter before the number is the expected ancestral base pair in this position and the letter after the number is the base pair in this new species.

Barcode sequence of the holotype: Sample NVG-2970, GenBank accession OK641922 View Materials , 658 base pairs: AACTCTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGGTACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA TAAACAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATAGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCC TATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATCACTATACTCCTCACTGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂, has four rectangular labels: three white, one handwritten [April 7, 1961 ♂ | Acapulco | Mexico | Coll. by J. Legge], others printed [DNA sample ID: | NVG-2970 | c/o Nick V. Grishin], [genitalia | NVG141101-01 | Nick V. Grishin] and one red [HOLOTYPE ♂ | Hermeuptychia | occidentalis Grishin ]. The holotype is illustrated in Figs. 11–12 View Figs (genitalia Fig. 33e–h View Fig ) and is in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [ USNM] . Paratypes: 2 ♂♂ and 1 ♀, from Mexico: ♂ Jalisco, near Pitillal , 3-May-1985, leg. Glenn R. Scott, DNA sample NVG-2789 ; ♂ Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979, genitalia NVG14101-10 [ USNM] ; ♀ Guerrero, Acapulco , 7-Apr-1961, leg. J. Legge, DNA sample NVG-2971, genitalia NVG14101-02 [ USNM] .

Type locality. Mexico: Guerrero, Acapulco .

Etymology. The name refers to the western distribution of this species. The name is a feminine adjective.

Distribution. This species is known from southwestern Mexico (Jalisco, Morelos, Guerrero).