Hermeuptychia sinuosa Grishin, 2021

Hermeuptychia sinuosa Grishin , new species

http://zoobank.org/ 026F9922-541B-466C-B25E-34739C18C1BD

( Figs. 1–10 View Figs , 33a–d, j, k View Fig , 36 View Fig part)

Description and diagnosis. On average smaller than its congeners (forewing length 14-16 mm), wings rounder and of similar shape in both sexes, dorsally unspotted brown, ventrally with postmedian eyespots typically very small, nearly equal to each other in size, five on forewing and six on hindwing (some may be vestigial, especially on forewing), hindwing eyespots 2, 5 & 6 (counting from costa) developed best, usually black, yellow-ringed and pupillated with pale metallic blue. Recognized by a well-expressed and wavy (sinuous) submarginal line placed at some distance from the two thinner marginal lines, hindwing 6 th eyespot on this line, 1 st eyespot usually replaced by a white dot (sometimes a patch of cream-white scales overlays a small eyespot), making such specimens identifiable by this character. These cream-white scales forming the dot are different from iridescent scales that pupillate eyespots. Median lines are darker at veins in some specimens, which is another character atypical for Hermeuptychia . Male genitalia distinctive ( Fig. 33a–d View Fig ): uncus narrow, in dorsal view lanceolate, widest near the distal third, apex truncated, nearly straight (not strongly bent ventrad) in lateral view, without carina; saccus long and narrow, about as long as vinculum; valva nearly straight, only slightly concave ventrad in the middle, without a deep notch, dorsally narrows gradually towards cucullus, then more abruptly past the base of cucullus, which narrows further to a point, slightly upturned; aedeagus as long as valva, not expanded at its base. Female genitalia ( Fig. 33j, k View Fig ) with antrum small comparatively to other species, weakly sclerotized, obcordate in shape, widest near its distal third, in dorso-ventral dimension thin and appears flattened, not cup-like as in most congeners.

Barcode sequence of the holotype: Sample NVG-2307, GenBank accession OK641921 View Materials , 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCATTAAGTTTAATTATTCGAATGGAATTAGGTAATCCAGGATTTTTAATTGGGGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATCCCCTTAATATTAGGAGCTCCTGATATAGCCTTCCCACGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATAGAGGATCATCGGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCT TATGATCAAATACCTTTATTTATCTGAGCTGTAGGAATCACAGCTCTTCTTTTACTTCTTTCCTTACCCGTTTTAGCGGGAGCTATTACTATACTTCTTACCGACCGTAATTTAAATACAT CATTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATACCAACATCTATTT

Type material. Holotype: ♂, has four rectangular printed labels: three white [GTM.ElProgreso.002 | Morazan | DurdenCJ 90010A07], [DNA sample ID: | NVG-2307 | c/o Nick V. Grishin], [NVG140403- 35] and one red [HOLOTYPE ♂ | Hermeuptychia | sinuosa Grishin ]. The locality label stands for Guatemala: El Progreso, Morazan, above k99 , leg. C. J. Durden, 10-Jan-1990. NVG140403-35 is a genitalia preparation number, genitalia vial placed on the same pin with the specimen. The holotype is illustrated in Figs. 1–2 View Figs (genitalia Fig. 33a–d View Fig ) and is currently in the University of Texas at Austin collection, Austin, TX, USA [ TMMC] . Paratypes: 4 ♂♂ and 3 ♀♀, all from Mexico: ♀ Colima, Mar-1922, BMNH(E) #834698 , ♂ Morelos, Cuernavaca, BMNH(E) #834699 , ♂ Guerrero, Nov-1916, BMNH(E) #806416 , ♀ Guerrero, Sierra de Guerrero , "Dec. 12" [probably 12-Dec-?], DNA sample NVG-2981, genitalia NVG141101-12 [ USNM] , ♂ Oaxaca, Chiltepec, 2-Nov-1969, RLR, DNA sample NVG-14112 H06 , ♀ Veracruz, Catemaco, Dos Amates , 23-Sep-1972, RLR, DNA sample NVG-14112H07 , ♂ no data label [likely from one of the two "RLR" localities above], DNA sample NVG-14112 H05 .

Type locality. Guatemala: El Progreso, Morazán .

Etymology. The name refers to the sinuous submarginal dark line on wings beneath. The name is a feminine adjective.

Distribution. In addition to the type locality in Guatemala, this species is widely distributed in Mexico (Colima, Morelos, Guerrero, Oaxaca, Veracruz).

Comments. This species was at times identified as Hermeuptychia lupita (Reakirt, [1867]) (type locality Mexico: Veracruz) ( Warren et al. 2016), which is incorrect, as also pointed out by Viloria (2021). Facies of Hermeuptychia sinuosa sp. n. do not agree with the original description of Neonympha lupita . In particular, the former species is smaller (wingspan <1.15 vs. 1.25 inches in N. lupita ), and the wing pattern of the ventral side differs: the new species typically has more than 4 eyespots (1 forewing, 3 hindwing in N. lupita ) and lacks additional (to the three median lines) "transverse lines" on the hindwing "towards the base" ( Reakirt [1867]).