Hesperia erratica Plötz, 1883

Lectotype designation for Hesperia erratica Plötz, 1883 View in CoL

Hesperia erratica Plötz, 1883 (type locality in Guatemala), currently a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia), was described from an unstated number of specimens from Guatemala (Plötz 1883). One specimen, shown in Fig. 50a, is curated in the MFNB collection as a syntype of H. erratica . We determine that this specimen is indeed a syntype. First, it agrees with the original description, which we translate as: “Yellow on both sides, all wings dark at the base and outer margin. Hindwing underside straw-yellow, at the base pale-brown with yellow spot, cell 1b is overscaled with pale-brown. Three such spots are in an oblique line in cell 1c, 2, and 3, one spot in the discal cell near the brown base, and a patch in the corner of cell 6. In cell 7 at the apex, there is a small brown spot, like the previous ones, and in cell 6, the narrow uneven border begins, ending at vein 1b. Upperside dark-yellow, forewing with brown-powdered [refers to the following list], the apical spots ending at the costal margin, such long spot in cells 4 and 5, and a dark brown cross vein. Hindwing with a brown costal margin, narrow in cells 4 and 5, then rapidly widening outer border, and a broad inner margin. Fringes of the forewing light brown, and of the hindwing yellow.” The description does not mention a diffuse discal spot in hindwing cell 5 (i.e., M 1 -M 2) beneath, present in the syntype, but all its other characters are in very good agreement with the description.

Second, according to its labels, this candidate syntype specimen from the Weymer collection was seen by Plötz, who identified it at the time as “ zabulon Bd. ” (“best[immt]. v[on]. Plötz”). Subsequently, Plötz likely changed his mind because, in his publication with the key describing H. erratica , he placed it after his “ zabulon ”, which was actually Lon hobomok (T. Harris, 1862) (type locality in USA: Massachusetts) (Plötz 1883). This is also corroborated by the opinion of Godman (1907), who inspected the original Plötz drawings of “ zabulon ” (t[afel]. 655) “from Buffalo” and concluded that they “represent A. hobomok .” Thus, Plötz’s “ zabulon ” was L. hobomok , and Plötz probably proposed the name erratica for the true L. zabulon , represented by this specimen, after he realized that two species were involved (see specimen labels below). Third, the specimen bears a label with “Erratica Plötz i l.” in Weymer’s handwriting, meaning that this name was given to Weymer by Plötz before publication of the name (therefore “i. l.”, for “in litteris”). Fourth, Godman (1907), who inspected Plötz original drawing of H. erratica (t[afel]. 656), identified it as male “ Atrytone zabulon ” in accord with the identity of the syntype.

We were not able to find other syntypes, and to stabilize nomenclature, N.V.G. hereby designates the sole syntype in the MFNB collection, a male with the following seven printed (but 2 nd, 3 rd, and 4 th

and. Art], [ Erratica Plötz i l. | taf. 656. Guatemala], [ Erratica Pltz | i.l. | Guatemala], [Coll. Weymer], [{QR Code} http://coll.mfn-berlin.de/u/ | 44a0bc], and [DNA sample ID: | NVG-18052B03 | c/o Nick V. Grishin ] as the lectotype of Hesperia erratica Plötz, 1883 . The last two lines on the 2nd label are abbreviated and should read “no 92 bestimmt von Plötz | ist möglicherweise andere Art”, which we translate as “no 92 identified by Plötz | is possibly a different species”, an indication that Plötz would change his opinion about the determination of this specimen as “zabulon .” The COI barcode sequence of H. erratica lectotype, sample NVG-18052B03, GenBank OR837740, 658 base pairs, is: AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837])

Genomic tree of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveals that the lectotype of Hesperia erratica Plötz, 1883 (type locality in Guatemala, sequenced as NVG-18052B03, Fig. 50a) is in the clade with specimens from the USA ( Fig. 51 violet) and not with specimens from Mexico and Central America, including El Salvador and Costa Rica ( Fig. 51 blue, a species different from L. zabulon , see below). Therefore, we confirm H. erratica as a junior subjective synonym of L. zabulon but propose that its type locality given as ‘Guatemala’ in the original description and on the lectotype labels was erroneous and should be corrected to the USA. Sequencing of L. zabulon specimens across the range will allow us to determine the type locality more precisely.

Even from the wing patterns of the lectotype, as also hinted in the original description of H. erratica , it is more likely to be from the United States than Guatemala. First, orange-yellow on the dorsal forewing is more extensive than in Central American specimens, i.e., the triplet of subapical spots is connected to the doublet of submarginal spots ( Fig. 50a), while in Central American specimens, they are typically well-separated from each other ( Fig. 50b). This character is also described for H. erratica by Plötz (1883) as a “long spot in cells 4 and 5”, meaning that there is a yellow background (i.e., “upperside dark-yellow”) that is formed by subapical and submarginal yellow spots together with the rest of the wing (except the marginal brown border) and there is a separate brown spot on this background. Instead, specimens from Central America would be described as having 3 yellow subapical and 2 submarginal spots on a brown background by the apex. Second, the ventral hindwing brown border by the outer margin is described by Plötz as “narrow uneven” ( Fig. 50a), which is more typical for specimens from the US. This border is usually broader and more even in Central American specimens ( Fig. 50b).

Looking more into the discrepancy about the type locality, we find that only two species of Hesperiidae proposed by Plötz have the type locality listed as “ Guatemala.” In addition to H. erratica , the second one is Achlyodes gorgona Plötz, 1884 , a junior subjective synonym of Gesta invisus (Butler & H. Druce, 1872) . A possible syntype of A. gorgona is from the Möschler collection (now in MFNB). It was collected in Guatemala in 1884 according to its dedicated locality/collector/date green label, which is likely correct. The type(s) of H. erratica would have been from an earlier collection event because the name was published in 1883. Moreover, unlike A. gorgona , it lacks a dedicated locality label. Therefore, it is unclear whether the type locality in Guatemala is accurate for H. erratica . Localities for the specimens collected in the US were known to be incorrect or missing. At least two mistakes have been documented. First, Goniloba parumpunctata Herrich-Schäffer, 1869 (type locality not stated in the original description, but later assumed to be in South America, possibly Venezuela), which is a junior subjective synonym of Lerema accius (J. E. Smith, 1797) (type locality in USA: Georgia) had the locality of the lectotype (male) and at least one female paralectotype deduced to be in eastern US by genomic sequence comparison (Zhang et al. 2023a). Second, Pyrgus argina Plötz, 1884 (type locality given as “Brisbane” [ Australia]), which is a junior subjective synonym of Amblyscirtes hegon (Scudder, 1863) (type locality in USA: New Hampshire, White Mountains), is only known from the USA ( Evans 1949).

http://zoobank.org/ AA859D18-CFC6-47F8-9032-AB5B6D79EB69

( Figs. 50b, 51 part, 52)

Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) ( type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names ( Fig. 51). One of these clades consists of specimens from Mexico and Central America ( Fig. 51 blue) and differs from L. zabulon by Fst / Gmin /COI barcode of 0.49/0.01/3% (20 bp) thus representing a new species. This species differs from L. zabulon in reduced orange-yellow areas on wings, e.g., broader brown borders and a smaller, disconnected triplet of subapical spots and a doublet of submarginal spots on forewing; ventral hindwing with broader and more even outer border and larger spots ( Fig. 50b); the process of aedeagus is more robust ( Fig. 52a, e–j). Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly596.8.5:A189G, aly596.8.5:A192T, aly806.32.1:T876C, aly806.32.1:A1101G, aly1097.21.1:G46A and in COI barcode: T82C, G101A, T292C, C376T, T457C, T478C.

Barcode sequence of the holotype. Sample NVG-18115B03, GenBank OR837741, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCACTAACATTATTAATCTCAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC TCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAACTTAATG TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAACACTT CATTTTTTGATCCAGCAGGGGGAGGAGATCCAATTTTATATCAACACTTATTC

Type material. Holotype: ♂ deposited the National Museum of Natural History , Washington, DC, USA

Taxco, IX-14-82 | 1850–1900 m], [ J. A. Powell | J. A. Chemsak | collectors], [ Poanes zabulon | ( Boisduval & Le Conte) | ♂ | det. J. M. Burns 1992], [DNA sample ID: | NVG-18115B03 | c/o Nick V. Grishin ], [USNMENT | { QR Code} | 01531551], and one red [ HOLOTYPE ♂ | Lon co | Grishin ]. Paratypes: 8♂♂: Mexico: 1♂ Tamaulipas, 11 km NW Gomez Farias , 6 km W Rancho Cielo, el. 5200- 5500 ft, 9-Jul-1965, genitalia vial NVG231115-03 (NVG-22056F05) [ TMMC]; 1♂ Veracruz, 10 km W Coscomatepec, el. 1800 m, 12-Aug-1987, Brown & Powell leg, genitalia vial J. M. Burns X-2953 (NVG-19068D12, USNMENT 01559668) [ USNM]; 1♂ Puebla, 6 mi N Chapulco, el. 7000', 4-Oct-1975, J. Powell, T . Eichlin & T . Friedlander leg. (NVG-18115B02, USNMENT 01531550) [ USNM]; Oaxaca, 5- 10 mi N of Oaxaca, el. 6000-7000 ft, J. Kemner leg.: 1♂ 22-Aug-1992 (NVG-18115B04, USNMENT 01531552) [ USNM] and 1♂ 30-Aug-1989, genitalia vial NVG231115-02 (NVG-22056E08) [ TMMC]; 1♂ Chiapas, 12 km S of Las Casas , 26-28-Mar-1959, T . C. Emmel leg. (NVG-18115B05, USNMENT 01531553) [ USNM]; 1♂ El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, C. F. & S. Hevel leg. (NVG-18115B06, USNMENT 01531554) [ USNM]; 1♂ Costa Rica, Puntarenas Prov., Monteverde , el. 1300 m, 18-May-1985, J. A. Chemsak leg. (NVG-18115B07, USNMENT 01531555) [ USNM] .

Type locality. Mexico: Guerrero, 5–7 km NW of Taxco.

Etymology. The name is the last syllable of the country name of the type locality: [Mexi] co. The name is a noun in apposition.

Distribution. Mexico to Costa Rica.