Pellicia (Hemipteris) zamia (Plötz, 1882)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 124-126

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16807607

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B03-7276-FEB6-FABAABF2F95A

treatment provided by

Felipe

scientific name

Pellicia (Hemipteris) zamia (Plötz, 1882)
status

 

Pellicia (Hemipteris) zamia (Plötz, 1882) View in CoL is a valid species distinct from Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870

Genomic sequencing of a syntype of Pellicia zamia Plötz, 1882 (type locality in South America, sequenced as NVG-15032E08), currently a subspecies of Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870 (type locality in Mexico and La Guaira, [ Venezuela], a syntype from Venezuela sequenced as NVG-15032E10), reveals that it is not monophyletic with it and instead belongs to the subgenus Hemipteris Mabille, 1889 (type species Hemipteris fumida Mabille, 1889 , currently treated as a junior subjective synonym of Pellicia tyana Plötz, 1882 , but see below) and is closely related to Pellicia (Hemipteris) meno (Mabille, 1889) , stat. rest. (type locality in Panama, holotype sequenced as NVG-15032E05) ( Fig. 90 View Fig ). Because P. zamia is not conspecific with any older name in this subgenus, we propose that Pellicia (Hemipteris) zamia Plötz, 1882 , stat. rest. is a valid species distinct from Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870 . We hypothesize that Evans (1953) placed P. zamia as a subspecies of P. dimidiata because he misidentified P. zamia , and the specimens he identified as “ P. zamia ” are probably Pellicia theon Plötz, 1882 (type locality in South America, lectotype sequenced as NVG-15032E09 and shown in Fig. 91a View Fig and Godman’s (1907) copy of the original Plötz’s drawing t. 200 in Fig. 91b View Fig ), which he misidentified as well, and the specimens he identified as “ P. theon ” may be, at least in part, Pellicia nema Williams and Bell, 1939 (type locality in Brazil: Mato Grosso, holotype sequenced as NVG-15097B11).

______________________________________________________________________________________________________

In the light of all these misidentifications, to stabilize nomenclature and define the name P. zamia objectively, N.V.G. hereby designates the sequenced syntype in the MFNB collection that is shown in Fig. 91c View Fig , is similar to Godman’s (1907) copy of Plötz’s original drawing t. 201 ( Fig. 91d View Fig ), and bears the following nine labels (1st red, others white; 3rd to 7th handwritten, others printed): [typus], [Coll. Weymer], [ Pellicia (156d) | Zamia Pl. ], [H S | 46 | Weymer], [52 | Weymer], [26:16.], [ Zamia Plötz il. | Amer.mer.], [{QR Code} http://coll.mfn-berlin.de/u/ | 940b9c], [DNA sample ID: | NVG-15032E08 | c/o Nick V. Grishin ] as the lectotype of Pellicia zamia Plötz, 1882 . Handwriting on the 2nd and 7th labels matches that of Plötz and Weymer, respectively. The label [26:16.] corresponds to the number for P. zamia in Mabille’s catalog (1903). The mitochondrial genome of the lectotype is very similar to that of a specimen from Venezuela. Therefore, we suggest that the type locality of P. zamia may have been in Venezuela, but sequencing of additional specimens across the range is needed to support this more convincingly. The lectotype is missing its abdomen, and its right hindwing is torn from the outer margin near the costa almost to the base. Images of this specimen ( Fig. 91c View Fig ) photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032E08, GenBank PV550033, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTACTTATTCGATCTGAATTAGGTACTCCTGGTTCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGTGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGTTGAACTGTTTATCCTCCTTTATCAGCTAATATTGC CCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATCAATATACGAGTTAATAATTTATTA TTTGATCAAATGCCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTCGACCCTGCAGGAGGCGGAGATCCAATTTTATATCAACATTTATTC

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

SubFamily

Pyrginae

Tribe

Carcharodini

Genus

Pellicia

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF