Vacerra saltina Grishin, 2025

Vacerra saltina Grishin , new species

http://zoobank.org/ 22E207BC-AB16-4EA6-9445-4B055AB7D0DC

( Figs. 134 View Fig part, 137–138)

Definition and diagnosis. Genomic sequencing of a pair of specimens from Salta, Argentina, identified as “ Vacerra hermesia cecropterus ” reveals that they are not monophyletic with the lectotype of Vacerra cecropterus (Draudt, 1923) , stat. rest. (type locality in Bolivia: Rio Zongo, sequenced as NVG-18093D10) and are instead sister to both V. cecropterus and Vacerra hermesia (Hewitson, 1870) (type locality in Ecuador), being genetically differentiated from them at the species level ( Fig. 134 View Fig ); e.g., their COI barcodes differ by 2.7% (18 bp) (from V. cecropterus ) and 3.2% (21 bp) (from V. hermesia ). Therefore, these Argentinian specimens represent a new species. This new species keys to “ Vacerra hermesia cecropterus ” (O.8.7.(b)) in Evans (1955) but differs from its relatives by a combination of the following characters: subdued green dorsal overscaling that does not strongly stand out and is more olivebrown (not prominently blue-green as in V. hermesia ); the hyaline spot in the cell CuA 1 -CuA 2 being larger and more rectangular with less rounded corners and more aligned with the discal cell spot along their proximal margins: the two spots nearly form a short band separated by the vein; while in other species the spot in the cell CuA 1 -CuA 2 is rounder, especially at the anterior proximal angle, and is offset distad from the discal cell spot and is separated from it by a wider brown ground color area; a small but prominent cream-colored spot in the discal cell of the ventral hindwing; the lack of postdiscal cream-colored spots in ventral hindwing cells CuA 1 -CuA 2 and CuA 2 -1A+2A; and a size comparable to V. cecropterus and smaller than V. hermesia . Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2627.10.2:G105A, aly159.12.16:C42G, aly159.12.16:G54C, aly 2790.11.3:G762A, aly 2790.11.3:G768A; and COI barcode: T205 C, T212 C, T278 C, T508 C, A631G.

Barcode sequence of the holotype. Sample NVG-23045D07, GenBank PV550060, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCACTAAGACTATTAATTCGTACAGAATTAGGTAACCCAGGATCTTTAATTGGAGACGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTTCCCCTTATACTAGGGGCCCCAGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCATCACTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACCGGTTGAACTGTTTATCCACCTCTATCTTCAAATATTGC CCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTCTGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACCATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGACCCAGCAGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 137 View Fig (genitalia Fig. 138 View Fig ), bears the following seven printed rectangular labels, six white: [ ARGENTINA Salta | (Oran) Agua Blanca | to Angosto, Rt 19 | km 28-30, 650-750 | m 17-ix-89 Leg R | Eisele 89S3], [ Vacerra hermesia | cecropterus (M) | Det Robert Eisele | ii-10], [ MGCL Accession | #2011-4 | Robert Eisele], [DNA sample ID: | NVG-23045D07 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24065B11 | c/o Nick V. Grishin ], [genitalia: | NVG241111-19 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Vacerra saltina | Grishin ]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 2♂♂ NVG-24065B12 & NVG-24065C01 and 1♀ NVG-23045D08, data as the holotype but km. 6–8 , nr. Quebrada del Remanso , 450 m, 20-May-1977 .

Type locality. Argentina: Salta Province, Orán, km 28–30 of Rt. 19 Agua Blanca to Angosto , elevation 650–750 m.

Etymology. The name is a fusion of Salt [a] + [Argent] ina for the type locality of this species and is treated as a feminine noun in apposition.

Distribution. Currently known only from northern Argentina.